DESCRIPTION

TOROIVD^®Probe 1-step RT-qPCR 5G kit 2.0 provides for sensitive, reproducible detection up to five RNA and DNA targets in a single multiplex reaction. Particularly useful for virus detection with TaqMan^®probe assays, the kit includes UNG, dsDNase, thermostable MMLV reverse transcriptase, RNase inhibitor, TOROIVD^®5G DNA polymerase and reaction buffer. The improved enzymes also enables a high resistance to PCR inhibitors and high stability in room temperature. The 1-step system is suitable for high-throughput analysis because of its simple reaction setup. In addition, this system can reduce the risk of cross-contamination with Uracil-N-glycoslyase（UNG）and dsDNase. The kit is suitable for high-speed RT-qPCR and enables accurate detection and quantification of targets, making it possible to obtain highly reproducible and reliable realtime PCR results over a wide dynamic range.  

Features

-Rapid and highly sensitive
 This kit can achieve the rapid and highly sensitive quantification of a low-copy targets  by a 1-step RT-qPCR method with probes and be suitable for the quantification of RNA/DNA viruses or mRNA expressed at a low level.  
-Optimized for multiplexing
  This kit has been validated for multiplexing up to five targets simultaneously, allowing for additional targets and/or controls to be run simultaneously for efficiency or quality control purposes.  
-Inhibitor tolerant
  The unique proprietary formulation of this kit allows robust performance even in the presence of substances that can normally inhibit PCR, such as heparin, hematin, or EDTA, increasing your confidence when working with a variety of complex clinical samples.  
-Wide dynamic range compatible with RNA and DNA
 This kit has been optimized to provide high specificity and dynamic range for use with both RNA and DNA targets. This input flexibility can help streamline the number of different workflows in your lab to improve
efficiency.  
-Broad instrument compatibility
 This kit can be run in either fast or standard cycling conditions with equivalent performance across a wide variety of real-time cyclers. The 50×ROX Reference dye（not supplied）is added can be applied to the real-time cyclers that require a passive reference dye.  
-Avoid Contamination
This kit contains dUTP in the reaction buffer and UNG and  small amounts of dsDNase in the enzyme mix. The crossed contamination caused by PCR product or dsDNA can be removed so that the rate of false-positive
detection can be reduced.    

Components

The kit includes the following  reagents, and QPR-303UD can be used for 200 reactions for a total 25μl reaction volume. All reagents should be stored at -20°C. 

Notes: 

-RT-qPCR Enzyme Mix UD contains UNG, dsDNase, TOROIVD^®III reverse transcriptase, RNase inhibitor and TOROIVD^®5G DNA polymerase. Bulk package of 1.3ml or 26ml per tube can be supplied . 

-2×5G qPCR Buffer BB  contains 0.4mM dA/C/G/T/UTP, 5mM Mg²⁺，reaction buffer and stabilizer，etc.). Bulk package of 12.5 ml or 40ml per tube can be supplied . 

NOT SUPPLIED

In some experimental applications, the following reagents may be used with  QPR-303UD, which are not supplied in this kit. Please contact us to order.

Notes: 

-2×5G qPCR Buffer GB can also be used instead of 2×5G qPCR Buffer BB in the kit for some experimental applications with higher sensitivity and specificity. 2×5G qPCR Buffer BB is more suitable for the amplification of short amplicon（≦100bp）and direct RT-qPCR.

-Enzyme Mix Dilution Buffer（END-UD13）is used to dilute the RT-qPCR Enzyme Mix UD without changing the performance and stability of the Enzyme Mix. And the Maximum added volume is 1ml for per ml RT-qPCR Enzyme Mix UD.

-The 50× ROX reference dyes are used for analyses with instruments that correct for cross-talk between wells, such as the real- time PCR instruments by Applied Biosystems and Agilent Technologies. 0.5μl 50×ROX Reference Dye was added for a total 25μl reaction volume in when using the following instruments, Applied Biosystems 7300/7700/7900HT, StepOnePlus, etc. And 0.05 μl  was added for using the following instruments, Applied Biosystems 7500/7500Fast Step OnePlus, Agilent Technologies AriaMx, etc. No ROX Reference Dye is required when using other brand instruments, such as LightCycler 96/LightCycler 480 system (Roche), CFX96 Real-Time PCR Detection System (Bio-Rad), Smart Cycler System (Cepheid), etc.

-RNA Dilution&Storage Solution is a buffer that provides greater RNA stability than TE Buffer，RNase-free water and RNA Virus VTM medium. RNA Dilution&Storage Solution Solution is compatible with direct 1- step RT-qPCR.

PRIMER/PROBE DESIGN

-Design of primers

Primer length: 18–25bp; Tm of primer: 60–65°C; GC content: 40–60%;

Target length: 70–200 bp; Larger targets (>200 bp) tend to reduce the efficiency and specificity of amplification.

Purification grade: OPC or HPLC grade;

-Design of probes

Probe length: 20–30bp; Tm of probe: 65–70°C; GC content: 40–60%; Purification grade: HPLC.

-Checking the performance of primers and probes：
-Prepare a dilution series with five or more dilutions of template RNA/ssDNA. Perform RT-qPCR assay using the diluted RNA/DNA with the newly designed primers and probe, and draw a standard curve.  
-Confirm that the PCR efficiency is between 90% and 110% and R² is equal to or greater than 0.99. if the PCR efficiency or R² are outside of these ranges, the reaction conditions should be optimized. If this does not improve the result, the primers and/or probe should be redesigned. 

PROTOCOL

1. This kit should be fully thawed before use. Gently vortexed and briefly centrifuged. 

2. Purified or crude template RNA/DNA can be may be used directly or after dilution.

3. Prepare the following reaction mixture in a thin-walled qPCR tube or plate. 

4. Gently mix the  reaction solutions  and spin down in microcentrifuge. 

Notes：  

-For the direct RT-qPCR to crude template RNA, the MgCl₂ concentration may need to be optimized between 2.5-8mM of final concentration. BSA and Triton X-100 may need to be added to improve the performance of direct RT-qPCR.
-The primer concentration should be optimized between 0.2-0.8 μM and  TaqMan^® probe optimized between 0.1-0.4 μM  with 10-50 copies templates /reaction. So the best primers-probe concentration sets was selected by orthogonal design of experiments .

CYCLING CONDITIONS

The recommended 2-step PCR protocol is described below:

Notes：

-Use this protocol first and optimize PCR conditions when necessary. Perform 3-step PCR when using primers with low Tm values or when 2-step PCR is not feasible. 

-The indicated UNG treatment temperature can be optimized 25-37°C，and time between 0-5min.

-The indicated RT temperature can be optimized between 50-60°C and time  between 2-15min.

-The indicated Pre-denaturation temperature can be optimized 95-98°C，and time between 2min-5min. 

-The indicated denaturation temperature can be optimized 95-98°C，and time between 3sec-10sec. 

-The indicated Extension /Annealing temperature can be optimized 60-65°C，and time between 5sec-30sec. Fluorescence signal gathering should be set up at this step. 

Application data 

Example 1.  High sensitivity detection of 2-3 copies SARS-CoV-2 reference RNA.

Template RNA: 

SARS-CoV-2 reference RNA（GBW（E）091111，China）;

N Gene: 2.4×10⁵copies/ul; E Gene: 1.8×10⁵copies/ul; ORF1ab Gene: 0.70×10⁵copies/ul; Dilution factor is 10³，10⁴，10⁵ and 10⁶.

Primer and Probe：From China CDC

ORF1ab-F: 5`- CCCTGTGGGTTTTACACTTAA-3`  300nM

ORF1ab-R: 5`- ACGATTGTGCATCAGCTGA-3`   300nM

ORF1ab-P: 5`-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-3`BHQ1  100nM

N-F: 5`- GGGGAACTTCTCCTGCTAGAAT-3`  600nM

N-R: 5`- CAGACATTTTGCTCTCAAGCTG-3`  600nM

N-P: 5`-FAM-TTGCTGCTGCTTGACAGATT-3`TAMRA  200nM

Instrument：

Line Gene 9600 Plus Bioer.

Reagent：

2×5G qPCR Buffer GB （ASF101GB）& RT-qPCR Enzyme Mix UD（QPR303UD13）

Example 2.  LOD  comparison with Company N

Template RNA: 

   2.25copies /reaction  of ORF1ab Gene, 20 replicates

   2.75copies /reaction  of N Gene, 20 replicates

  Instrument：

ABI 7500

Reagent：

2×5G qPCR Buffer GB (ASF101GB) & RT-qPCR Enzyme Mix UD (QPR303UD13)

   
                           ORF -QPR-303UD（20/20）

                           ORF -Company N（14/20）

                         N -QPR-303UD（20/20）            

                           N -Company N（13/20）

Example 3. Contamination removal capacity of QPR-303UD

  Template: Purified PCR product by MS2RNA and QPR-303UD 

  Primer and Probe：

Forward primer:GCCTTAGCAGTGCCCTGTCT  400nM
   Reverse primer:AACATGCTCGAGGGCCTTA  400nM
  Taqman Probe:FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA 200nM

Instrument：

CFX 96

Reagents：

2×5G qPCR Buffer BB (ASF104BB) & RT-qPCR Enzyme Mix UD (QPR303UD13)

          Green：without UNG   Blue：QPR-303UD

Example 4. Thermal stability of  QPR303UD13 Enzyme Mix

Template: MS2RNA from Roche

Primer and Probe：

Forward primer:GCCTTAGCAGTGCCCTGTCT  400nM
   Reverse primer:AACATGCTCGAGGGCCTTA  400nM
  Taqman Probe:FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA 200nM

Instrument：

CFX 96
 

Reagents：

2×5G qPCR Buffer BB (ASF104BB) & RT-qPCR Enzyme Mix UD (QPR303UD13)

                Green：-20℃ Blue：7d at 37℃ 

                        1.3μl QPR303UD13/25μlreaction 

                1.5μl Enzyme Mix /25μlreaction
                   (0.2μl END-UD13 added)

        2.5μl Enzyme Mix /25μlreaction

          (1.2μl END-UD13 added)

STORAGE

This reagent can be stored at 4°C for 2 months. For longer storage,  this reagent should be kept at -20°C for 2 years.

ORDER INFORMATION 

More bulk package can be supplied，please contact us.