DESCRIPTION

TOROBlue® qRT Premix with gDNA Eraser enables fast cDNA synthesis for 2-step RT-qPCR and includes a rapid step that eliminates genomic DNA contamination without loss of input RNA. Genomic DNA is eliminated by treating the RNA templates with gDNA Eraser Mix for 2-5 minutes at 37°C. 5×qRT Premix contains  primers and buffer optimized for highly efficient synthesis of short-chain cDNAs suitable for qPCR. The protocol is simple, and the reaction can be completed in 10-25 min.                     .

COMPONENTS

The kit includes the following reagents,which can be used for 100 reactions for a total 10µl reaction volume.
Cat NO ：RTQ-201   

RNA Dilution Buffer               1ml/tube

gDNA Eraser Mix                  200µl/tube              

5×qRT Premix                     200 µl/tube 

RT Enzyme Mix                     100µl /tube 

Notes:

-RNA Dilution Buffer can be used to dilute and store RNA instead of RNase-free water.  

- gDNA Eraser Mix contains Heat labile dsDNA Nuclease, RNase inhibitor, and reaction buffer.  

- 5×qRT Premix contains oligo dT primer, random primer, and reaction buffer.    

-RT Enzyme Mix  contains the highly efficient reverse transcriptase and an RNase inhibitor. 

PROTOCOL

1. Preparation of the reagent and templates

-This kit should be fully thawed before use. Gently vortexed and briefly centrifuged. 

-Purified template RNA can be may be used directly or after dilution。 

2. Genomic DNA elimination reaction

-Prepare the following  reaction in a thin-walled PCR  tube one the ice.

-Incubate at 37℃ for 5 min. Store the reaction tube one ice.

Notes:

-The indicated  time of  gDNA elimination reaction is between 2-5min at 37℃.

-Up to 0.5μg of total RNA template for qPCR assay.

3. Reverse-transcription 

-Transfer 2μL 5×qRT Premix and 1μL RT Enzyme Mix into the above reaction tube. Gently vortexed and 

briefly centrifuged. 

-RT reaction as the following condition.

37℃    15min 

50℃    5min 

98℃   5 min

-Store the reaction tube one ice.

Notes:
-The cDNA products can be used directly or after  dilution for real-time PCR. Up to 20% of the synthesized cDNA solution can be added to the PCR reaction solution.
 -The mutant M-MLV reverse transcriptase excels at high reaction temperatures (up to 60℃). This step may increase the efficiency of the reverse transcription. 

APPLICATION DATA

1. Efficiency of gDNA elimination.
  RT Reagent: TOROBlue® qRT Premix with gDNA Eraser（RTQ-201）

Template: Human Genomic DNA 50ng/reaction

Experiment groups:

-Store the reaction tube one ice.

 qPCR Reagent:  TOROGreen®qPCR Master Mix (Code No.QST-100).

Template: cDNA 2μL/20μLreaction

Target:GAPDH (Non cross-intron)

Forward primer：AAAAGGGCCCTGACAACTCTT

Reverse primer：GTCTTACTCCTTGGAGGCCA

Instrument ： CFX-96 from Biorad

Results：

 Despite the gDNAcontamination, the results of RTQ-201 correlate highly with those of the RTQ-100. Both reagents showed highly linear standard curves in a broad concentration range

STORAGE

This reagent should be kept at -20°C for 1 years.

ORDER INFORMATION 

Bulk package can be supplied，please contact us .