Evolving Enzymes
Inovating IVD
RNA Dilution&Storage Solution is a buffer that provides greater RNA stability than TE Buffer or RNase-free water. The last step in every RNA isolation protocol is to resuspend the purified RNA pellet. After painstakingly isolating the RNA, it is crucial that the pellet be suspended and stored in a safe, RNase-free solution.RNA Dilution&Storage Solution has two features that keeps RNA stable: a low pH of 7.0, and a Chemical RNase Inhibitor. RNA Dilution&Storage Solution Solution is compatible with all common RNA applications such as reverse transcription, RT-PCR, 1- step RT-qPCR, in vitro transcription, northern analysis, and nuclease protection assays.
【Description】
RNA Dilution&Storage Solution is a buffer that provides greater RNA stability than TE Buffer or RNase-free water. The last step in every RNA isolation protocol is to resuspend the purified RNA pellet. After painstakingly isolating the RNA, it is crucial that the pellet be suspended and stored in a safe, RNase-free solution.RNA Dilution&Storage Solution has two features that keeps RNA stable: a low pH of 7.0, and a Chemical RNase Inhibitor. RNA Dilution&Storage Solution is specially designed for 1- step RT-qPCR kit from TOROIVD and incompatible with other brand kits.
【Feature】
-RNA Dilution: this product can be used to dilute RNA instead of RNase-free water(such as DEPC treated water) in 1- step RT-qPCR, and keep the RNA stable.
-RNA Storage: this product can be used to dilute and store RNA instead of RNase-free water or TE Buffer, and can keep RNA more stable in room temperature.
【Components】
Cat NO.
Components
Size
RDB-100
RNA Dilution&Storage Solution
100mL/bottle.
【Storage】
This reagent can be stored at 2-8°C for 24 months and protected from light.
【Documents】
Brochures: Real-time PCR Premix for gene expression analysis- MSDS： Material Safety Data Sheet for RDB-100
- COA： Certificate of Analysis for RDB-100
【Order information】
Catalog Number | Product Name | Unit Size | Price |
RDB-100 | RNA Dilution&Storage Solution | 100mL/bottle. | US$ |
【Application】
Dilution Solution：
A: RNA Dilution&Storage Solution（TOROIVD）
B:The RNA Storage Solution（Company T）
Template :
Add 50μl 0.8ng MS2RNA 1 ml of the above two solutions (from TOROIVD and Company T) respectively and store at 25℃ and 37℃.
Primer and Probe：
Forward primer:GCCTTAGCAGTGCCCTGTCT 400nM
Reverse primer:AACATGCTCGAGGGCCTTA 400nM
TaqmanProbe:FAM-CCCGTGGGATGCTCCTACATGTCA-TAMRA 200nM
qPCR Reagent:
TOROIVD® Probe 1-step RT-qPCR 5G Kit 2.0
Instrument：
ABI-7500
Results:
Fig 1. The RNA template amount in the two two solutions was basically the same.
Fig 2. RNA Dilution&Storage Solution from TOROIVD keeps RNA more stable at 25℃ or 37℃ for 3days than the RNA Storage Solution from Company T.
