PRODUCT CENTER
TOROGreen® qPCR Master Mix
    Publish time 2018-09-26 15:52    

A dye qPCR mix for gene express analysis is designed by the MIQE guidelines, with the features of high specificity, room-temperature stability and Wide dynamic range.

TOROGreen® qPCR Master Mix



【Description】

  • TOROGreen® qPCR Master Mix is a Taq DNA polymerase-based 2× master mix for realtime PCR, which contains all components, except for the primer. The master mix is applicable for intercalation assay with SYBR Green I and can be used in glass capillary systems or passive reference system. Hot Start technology with Taq polymerase antibodies enables high specificity and reproducible amplification. The specially optimized PCR buffer make the mix more efficient amplification of GC-rich templates and more stable at room temperature. According to the MIQE guidelines, a master mix should not have primer dimers amplification in NTC tests. Compared with other brands, this master mix greatly reduces the formation of primer dimers. Therefore, this premix makes qPCR primer design easier while meeting MIQE requirements.

【Feature】

  • -High specificity: High efficiency Taq antibodies and optimized PCR buffer greatly reduce the formation of primer dimers, so it easily meets MIQE requirements.

  • -Room-temperature stable: the performance is not easily decrease during storing and shipping. 

  • -Wide dynamic range: the mix demonstrates excellent reproducibility over a wide dynamic range and provides efficient amplification over 8 logs of sample. input.

【Components】

  • QST-100 can be used for 1000 reactions for a total 20µL reaction volume.

  • Cat NO.

    Components

    Size

    QST-100

    TOROGreen® qPCR Master Mix  

    1 mL ×10tubes/ Kit



【Storage】

  • This reagent can be stored at 2-8°C for 12 months and protected from light. 

  • For longer storage, this reagent should be kept at -20°C and protected from light. 




【Primer Design】

  • - Primer length: 18~30bp - GC content of primer:  40~80%   -Target length:  ≤ 200 bp (optimally, ≤ 150bp)

  • -Checking the primers:

  • -NTC tests can distinguish unintended amplification products of  primer dimers  from the intended PCR products in SYBR Green I reactions. NTC test is required to verify the each of primers for assessing the extent of primer dimers. The primer of NTC with Cq<40 should be redesigned. 

  • -Prepare a dilution series with five or more dilutions of template DNA. Perform qPCR assay using the diluted  DNA with the newly designed primers and draw a standard curve. Confirm that the PCR efficiency is between 95% and 105% and R2 is equal to or greater than 0.99. If the PCR efficiency or R2 are outside of these ranges, the primers concentration and reaction conditions should be optimized. If this does not improve the result, the primers should be redesigned.

【Template DNA】

  • -Genomic DNA:  Purified DNA, which would be used for general PCR, is also suitable for real-time PCR. In the case of mammalian genomic DNA, 1~10 ng genomic DNA is sufficient for real-time PCR. 

  • -cDNA :  Reverse transcription reactions from total or poly (A)+RNA may be used directly, or after dilution for realtime PCR. Before the reverse transcription reaction, it is essential to assess the extent of genomic DNA contamination with no-reverse transcription control. If genomic DNA contamination affects the Cq values, it is essential to be eliminated by DNase treatment.

【Detection】

  • This reagent can be used in general detection devices, not needing ROX such as: LineGene(bioer); LightCycler (Roche); iCycler iQ, CFX96(Biorad/MJ); Thermal Cycler Dice(Takara); This reagent with 1× ROX can also be used in detection equipment using passive reference, such as:ABI PRISM 7000, 7700, 7900, 7300; Step One, Step one plus etc.(ABI), ABI PRISM  7500, 7500Fast(ABI); Mx3000P, 3005P, MX4000, etc.(Agilent).




【Example】

   1. High stability verification

       -Template DNA: Eight 10×Dilutes of the pET28a plasmid with  Bacillus badius phenylalanine dehydrogenase  gene.

       -Primer:Forward primer AGGAAGCCGATGTGTTCGTT Reverse primer TTCCGCTTGCTGGTACACTT

       -Reagent: QST-100 stored at 37 ℃ and at -20 ℃ for 1 weeks.


  • Result: From the amplification curve, it shows that the QST-100 stored at 37 ℃ and  at -20 ℃ have the same curve, and the Cq value is basically similar. From the standard curve, it shows that the PCR efficiency of QST-100 at different stored temperatures are both at  95% -100%, and the R2 value is 0.999.

  • Conclusion: QST-100 has extremely high stability and excellent PCR efficiency, with excellent linear relationships over a wide range of template concentration.

   2.  Comparison of the specificity between QST-100 and Brand N

  • -Template DNA: Eight 10×Dilutes of the pET28a plasmid with Bacillus badius phenylalanine dehydrogenase gene.

  • -Primer:Forward primer AGGAAGCCGATGTGTTCGTT Reverse primer TTCCGCTTGCTGGTACACTT

  • -Reagent: QST-100 and Brand N


  • Result: From the melting curve, it shows that QST-100 exhibits a single peak under both low and high concentration templates, while under low concentration templates, Brand N exhibits non-specific amplification.

  • Conclusion: QST-100 has a single peak in the melting curve, high specificity. It can meet the requirements of MIQE.

   3. Comparison of the PCR  Efficiency between QST-100 and Brand T

  • -Template DNA: Five 10×Dilutes of the pET28a plasmid with  Bacillus badius phenylalanine dehydrogenase  gene.

  • -Primer:Forward primer AGGAAGCCGATGTGTTCGTT Reverse primer TTCCGCTTGCTGGTACACTT

  • -Reagent: QST-100 and Brand T


  • Results: From the amplification curve, it shows that under the same template concentration, QST-100 peaked earlier than the brand T, and the Cq value was smaller. From the melting curve, it shows that neither reagent showed non-specific amplification, but the Tm value of QST-100 was lower than that of the imported brand T.

  • Conclusion: In the absence of non-specific amplification, QST-100 has high amplification efficiency and is conducive to template amplification with high GC content.




【References】

  •  Bustin SA, Benes V, Garson JA, etc,al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. ClinChem.2009,55(4):611-22.

【Application】

  • [1] Liu Q , Li X , Wu R , et al.Development of an on-spot and rapid recombinase polymerase amplification assay for Aspergillus flavus detection in grains[J].Food Control, 2021, 125(4):107957.

  • [2] Fei X , Ziqian W , Bingwu Y , et al.Aldosterone alleviates lipopolysaccharide-induced acute lung injury by regulating epithelial sodium channel through PI3K/Akt/SGK1 signaling pathway[J].Molecular and Cellular Probes, 2021.

  • [3]  Li SJ, He CF, Feng Q, et al.Establishment of two iPSC lines from healthy donor with heterozygous mutation in the SLC26A4 gene[J].Stem Cell Research, 2022,64:1873-5061.

  • [4]  Xu K , Meng Z , Xian X M , et al.LncRNA PVT1 induces chondrocyte apoptosis through upregulation of TNF-α in synoviocytes by sponging miR-211-3p[J].Molecular and Cellular Probes, 2020, 52:101560.

  • [5] Su X , Zhu Y , Hou Y , et al.PVT1 induces NSCLC cell migration and invasion by regulating IL-6 via sponging miR-760.[J].Molecular and cellular probes, 2020, 54:101652.

  • [6] Xia CP , Pan T , Zhang N,et al.Sp1 promotes dental pulp stem cell osteoblastic differentiation through regulating noggin[J]. Molecular and cellular probes, 2020, 50:101504.

  • [7] MY Xie, LH Yang, JY Cheng, et al.Gracillin relieves pulmonary fibrosis by suppressing the STAT3 axis[J].Journal of Ethnopharmacology, 2023,316:116704.




【Documents】




【Order information】  

  

Catalog Number

Product Name

Unit Size

Price

QST-100

TOROGreen® qPCR Master Mix

1 mL ×10tubes

US$ 300.00

 






TOROGreen® qPCR Master Mix.pdf